2.7: DNA replication, transcription and translation
Teaching time: 3 hours Practical time: 0 hours
key vocabulary
prior learning & retrieval practice
Review topic 2.6 DNA structure & Replication
Review topic 2.4 proteins
The central dogma of molecular biology
Essential Idea: Genetic information in DNA can be accurately copied and can be translated to make the proteins needed by the cell.
DNA Replication
Exercise 1: In groups discuss: what possible models of DNA replication can you come up with? If we start with one double "parental" DNA helix, how can we end up with two "daughter" DNA helices??
U2: Helicase unwinds the double helix and separates the two strands by breaking hydrogen bonds.
U3: DNA polymerase links nucleotides together to form a new strand, using the pre-existing strand as a template.
Guidance from the guide: The different types of DNA polymerase do not need to be distinguished.
Exercise 2: Fill in the blanks
DNA replication is . An enzyme called unwinds and separates the DNA strands at the origin. Each strand acts as a for the formation of a new strand. with the appropriate bases line up opposite the bases of the exposed strands. bonds form between the bases of the template and the new strand holding them in place. DNA causes the sugar and phosphate of adjacent nucleotides to condense and form bonds.
Exercise 3: Complete the table by inserting the name of the enzymes involved in replication and their functions
Table of enzyme functions
U1: The replication of DNA is semi-conservative and depends on complementary base pairing.
Exercise 3: Explain the importance of complementary base pairing for DNA replication
How do we know how DNA replicates semi-conservatively?
S2: Analysis of Meselson and Stahl’s results to obtain support for the theory of semi-conservative replication of DNA.
NoS: Obtaining evidence for scientific theories—Meselson and Stahl obtained evidence for the semi-conservative replication of DNA. (1.8)
Exercise 4: Watch the video and outline Meselson and Stahl's experiment.
Exercise 5: Complete the data based exercise on pages 113 and 114 of the Allott & Mindorff textbook.
Polymerase chain reaction (PCR)
A1: Use of Taq DNA polymerase to produce multiple copies of DNA rapidly by the polymerase chain reaction (PCR). This process is covered in topic 3.5 with 3.5 U2.
Protein Synthesis I: Transcription
U4: Transcription is the synthesis of mRNA copied from the DNA base sequences by RNA polymerase.
Exercise 6: Answer these questions
1. What are proteins made from?
2. What determines the properties of a protein?
3. What determines the properties of an individual polypeptide chain?
4. What determines the order of specific amino acids in a polypeptide?
Exercise 7: Fill in the blanks
Sequences of bases within the DNA molecule are into – a complementary copy of the code is made on an mRNA molecule.
The DNA double helix is and the hydrogen bonds are at the site of the sequence being transcribed by an enzyme called .
The sequence of only strand is copied into the mRNA molecule. This is achieved by using base pairing of nucleotides between the other DNA strand and the mRNA .
The reaction is catalysed by the enzyme , which unwinds the DNA double helix, creates covalent bonds between the RNA nucleotides and re-coils the DNA double helix
Once formed, the mRNA molecule leaves the nucleus through pores in the nuclear membrane and passes to ribosomes (either on the RER or in the cytoplasm where it can be read.
S4: Deducing the DNA base sequence for the mRNA strand.
Exercise 8: Transcribe the mRNA sequence from the following DNA base sequence:
ATCGGGCCGGCTTATTACCGGCTATAATACCGG
Protein synthesis II: Translation
U5: Translation is the synthesis of polypeptides on ribosomes.
U8: Translation depends on complementary base pairing between codons on mRNA and anticodons on tRNA.
Exercise 9: Read the relevant section of your text book and connect-extend-challenge. Then explain the importance of complementary base paring in translation.
The genetic code
U6: The amino acid sequence of polypeptides is determined by mRNA according to the genetic code.
U7: Codons of three bases on mRNA correspond to one amino acid in a polypeptide.
Exercise 10: Describe the genetic code in terms of triplets of bases (Keywords: Base, amino acid, codon, degenerate, punctuation)
S1: Use a table of the genetic code to deduce which codon(s) corresponds to which amino acid.
S3: Use a table of mRNA codons and their corresponding amino acids to deduce the sequence of amino acids coded by a short mRNA strand of known base sequence.
Exercise 11: Translate the mRNA sequence you transcribed earlier using the table.
The universality of the genetic code
A2: Production of human insulin in bacteria as an example of the universality of the genetic code allowing gene transfer between species. This topic is also touched on in topic 3.5 A2
