2.7: DNA replication, transcription and translation

prior learning & retrieval practice

Essential Idea: Genetic information in DNA can be accurately copied and can be translated to make the proteins needed by the cell.

Exercise 1: In groups discuss: what possible models of DNA replication can you come up with? If we start with one double "parental" DNA helix, how can we end up with two "daughter" DNA helices??

A1: Use of Taq DNA polymerase to produce multiple copies of DNA rapidly by the polymerase chain reaction (PCR). This process is covered in topic 3.5 with 3.5 U2.

U4: Transcription is the synthesis of mRNA copied from the DNA base sequences by RNA polymerase.

Exercise 6: Answer these questions

1.    What are proteins made from?

2.    What determines the properties of a protein?

3.    What determines the properties of an individual polypeptide chain?

4.    What determines the order of specific amino acids in a polypeptide?

Exercise 7: Fill in the blanks

Sequences of bases within the DNA molecule are                                                           into                                       – a complementary copy of the code is made on an mRNA molecule.

The DNA double helix is                                    and the hydrogen bonds are                            at the site of the sequence being transcribed by an enzyme called                                         .

The sequence of only                                           strand is copied into the mRNA molecule. This is achieved by using                                                         base pairing of nucleotides between the other DNA strand and the mRNA                                                                    .

The reaction is catalysed by the enzyme                                                                            , which unwinds the DNA double helix, creates covalent bonds between the RNA nucleotides and re-coils the DNA double helix

Once formed, the mRNA molecule leaves the nucleus through pores in the nuclear membrane and passes to ribosomes (either on the RER or in the cytoplasm where it can be read.

S4: Deducing the DNA base sequence for the mRNA strand.

Exercise 8: Transcribe the mRNA sequence from the following DNA base sequence:

ATCGGGCCGGCTTATTACCGGCTATAATACCGG

U5: Translation is the synthesis of polypeptides on ribosomes.

U8: Translation depends on complementary base pairing between codons on mRNA and anticodons on tRNA.

Exercise 9: Read the relevant section of your text book and connect-extend-challenge. Then explain the importance of complementary base paring in translation.

A2: Production of human insulin in bacteria as an example of the universality of the genetic code allowing gene transfer between species. This topic is also touched on in topic 3.5 A2